ID: 1020248348_1020248352

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1020248348 1020248352
Species Human (GRCh38) Human (GRCh38)
Location 7:6447920-6447942 7:6447940-6447962
Sequence CCGCCACCAAATTATCGGCGCTC CTCAAGCGCAAACGCAGCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28} {0: 1, 1: 0, 2: 0, 3: 5, 4: 24}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!