ID: 1020253004_1020253010

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1020253004 1020253010
Species Human (GRCh38) Human (GRCh38)
Location 7:6484192-6484214 7:6484213-6484235
Sequence CCGGCGCGCGCGCGCGCGGGGCA CACCCTGGGAGAGCGGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 177} {0: 1, 1: 1, 2: 1, 3: 49, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!