ID: 1020253004_1020253013

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1020253004 1020253013
Species Human (GRCh38) Human (GRCh38)
Location 7:6484192-6484214 7:6484229-6484251
Sequence CCGGCGCGCGCGCGCGCGGGGCA GGCCAGGCCCCGCCCCTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 177} {0: 1, 1: 0, 2: 0, 3: 11, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!