ID: 1020268659_1020268662

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1020268659 1020268662
Species Human (GRCh38) Human (GRCh38)
Location 7:6578572-6578594 7:6578586-6578608
Sequence CCAGGCTCCTGGAAGAACCATGT GAACCATGTCCGGCAGCTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 217} {0: 1, 1: 0, 2: 0, 3: 10, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!