ID: 1020271398_1020271405

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1020271398 1020271405
Species Human (GRCh38) Human (GRCh38)
Location 7:6598599-6598621 7:6598629-6598651
Sequence CCCCAGAGAGAGGGGGCTGAGGA CTGTGCACACAGGCAGCCTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 19, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!