ID: 1020274713_1020274724

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1020274713 1020274724
Species Human (GRCh38) Human (GRCh38)
Location 7:6617033-6617055 7:6617085-6617107
Sequence CCCGTTGCGGGGGACAGTCCTAT TGGGTGGCCCGAGGCAGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 28} {0: 1, 1: 1, 2: 1, 3: 39, 4: 436}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!