ID: 1020335581_1020335587

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1020335581 1020335587
Species Human (GRCh38) Human (GRCh38)
Location 7:7059878-7059900 7:7059894-7059916
Sequence CCTCTCCCCCTTGGATATATGAA ATATGAAACAATATGACAGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 29, 3: 154, 4: 823}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!