ID: 1020335583_1020335591

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1020335583 1020335591
Species Human (GRCh38) Human (GRCh38)
Location 7:7059884-7059906 7:7059918-7059940
Sequence CCCCTTGGATATATGAAACAATA GTGGACACACCTCGCCATATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 23, 3: 184, 4: 794} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!