ID: 1020336033_1020336040

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1020336033 1020336040
Species Human (GRCh38) Human (GRCh38)
Location 7:7063053-7063075 7:7063094-7063116
Sequence CCAATATCGCAGTGGGTGTACAC CTTAAAATCCAGGGAGGGAGAGG
Strand - +
Off-target summary {0: 22, 1: 213, 2: 906, 3: 1387, 4: 1521} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!