ID: 1020371060_1020371068

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1020371060 1020371068
Species Human (GRCh38) Human (GRCh38)
Location 7:7432455-7432477 7:7432496-7432518
Sequence CCTACTTTAAAGTCTTACCTTTG CACGTAAACCCATCGGCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 262} {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!