ID: 1020388013_1020388017

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1020388013 1020388017
Species Human (GRCh38) Human (GRCh38)
Location 7:7628865-7628887 7:7628912-7628934
Sequence CCTGCTCTAGTCAGTGGAGAGCC AAAATACTTTTTTTTTATTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 7, 2: 73, 3: 718, 4: 4577}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!