ID: 1020405458_1020405469

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1020405458 1020405469
Species Human (GRCh38) Human (GRCh38)
Location 7:7828554-7828576 7:7828605-7828627
Sequence CCCCATCCCTGCTGACTTCTGTG GGCTAAGGGGCTGCCTGTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 466} {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!