ID: 1020419322_1020419328

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1020419322 1020419328
Species Human (GRCh38) Human (GRCh38)
Location 7:7983198-7983220 7:7983241-7983263
Sequence CCTCTGACTATAACCATGTAAGA AGGAATTTTAGGAAATAGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 24, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!