ID: 1020419323_1020419325

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1020419323 1020419325
Species Human (GRCh38) Human (GRCh38)
Location 7:7983211-7983233 7:7983230-7983252
Sequence CCATGTAAGAAACTGTATAAAAT AAATTGTATGTAGGAATTTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 38, 4: 420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!