ID: 1020419323_1020419327

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1020419323 1020419327
Species Human (GRCh38) Human (GRCh38)
Location 7:7983211-7983233 7:7983238-7983260
Sequence CCATGTAAGAAACTGTATAAAAT TGTAGGAATTTTAGGAAATAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 35, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!