ID: 1020445510_1020445517

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1020445510 1020445517
Species Human (GRCh38) Human (GRCh38)
Location 7:8262573-8262595 7:8262610-8262632
Sequence CCGGCAGGTGTTCCACGTGGCCA CAATGACCTGGCGGACAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 159} {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!