ID: 1020465610_1020465613

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1020465610 1020465613
Species Human (GRCh38) Human (GRCh38)
Location 7:8475258-8475280 7:8475271-8475293
Sequence CCCTGCTGCTTGGTGTCCCCAGA TGTCCCCAGAGAGAATCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 276} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!