ID: 1020466539_1020466540

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1020466539 1020466540
Species Human (GRCh38) Human (GRCh38)
Location 7:8486020-8486042 7:8486038-8486060
Sequence CCTAGAAAGAGTTACTCTTGGGA TGGGATTTTAAAACATATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 139} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!