ID: 1020539340_1020539344

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1020539340 1020539344
Species Human (GRCh38) Human (GRCh38)
Location 7:9440523-9440545 7:9440554-9440576
Sequence CCAGGGCAATCAGGCAGGAGAAG GGGCATTCAATTAGAAAAACAGG
Strand - +
Off-target summary {0: 2758, 1: 5884, 2: 4851, 3: 4196, 4: 4617} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!