ID: 1020597300_1020597304

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1020597300 1020597304
Species Human (GRCh38) Human (GRCh38)
Location 7:10223771-10223793 7:10223795-10223817
Sequence CCTGGTCTCCACTTCCAAAGTGG GCCTTTAACCCTGAATTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 37, 4: 425} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!