ID: 1020605894_1020605895

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1020605894 1020605895
Species Human (GRCh38) Human (GRCh38)
Location 7:10336387-10336409 7:10336402-10336424
Sequence CCATATACGGATGGTCAGGTAAA CAGGTAAATTATACATTTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 19, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!