ID: 1020647225_1020647228

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1020647225 1020647228
Species Human (GRCh38) Human (GRCh38)
Location 7:10829519-10829541 7:10829544-10829566
Sequence CCTTCACTCTTCTAGAAGGCCAT TTTGTTAGGTCCTTTTTCCATGG
Strand - +
Off-target summary No data {0: 39, 1: 40, 2: 27, 3: 29, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!