|
Left Crispr |
Right Crispr |
| Crispr ID |
1020671774 |
1020671778 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:11124037-11124059
|
7:11124073-11124095
|
| Sequence |
CCTTACTTTTTCCTTTTCTTTTT |
TTCTGAAGAAAGTTGGTATCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 17, 2: 232, 3: 2092, 4: 15710} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|