ID: 1020700193_1020700198

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1020700193 1020700198
Species Human (GRCh38) Human (GRCh38)
Location 7:11472253-11472275 7:11472292-11472314
Sequence CCCCAAATCTTATTCAAGGTCAA AGGAACTGAAGTTTGTTACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 179} {0: 1, 1: 0, 2: 0, 3: 12, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!