ID: 1020702351_1020702362

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1020702351 1020702362
Species Human (GRCh38) Human (GRCh38)
Location 7:11499132-11499154 7:11499183-11499205
Sequence CCTCCAACAAGCTGCAGTTGACC TGGGATCCACACACCCTTCATGG
Strand - +
Off-target summary {0: 13, 1: 50, 2: 71, 3: 92, 4: 407} {0: 1, 1: 0, 2: 2, 3: 20, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!