ID: 1020702352_1020702362

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1020702352 1020702362
Species Human (GRCh38) Human (GRCh38)
Location 7:11499135-11499157 7:11499183-11499205
Sequence CCAACAAGCTGCAGTTGACCCAA TGGGATCCACACACCCTTCATGG
Strand - +
Off-target summary {0: 16, 1: 46, 2: 63, 3: 81, 4: 160} {0: 1, 1: 0, 2: 2, 3: 20, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!