ID: 1020766715_1020766718

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1020766715 1020766718
Species Human (GRCh38) Human (GRCh38)
Location 7:12331139-12331161 7:12331192-12331214
Sequence CCATTCTTAAGATACAGGCTTGT TCTTATCTGTAGTAGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 122} {0: 1, 1: 0, 2: 1, 3: 22, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!