ID: 1020766795_1020766804

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1020766795 1020766804
Species Human (GRCh38) Human (GRCh38)
Location 7:12332033-12332055 7:12332058-12332080
Sequence CCCTCCTTTGGGGAAGGTAGGGA AGGGGAGCAAGGGATGGAGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 71, 4: 784}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!