ID: 1020862760_1020862768

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1020862760 1020862768
Species Human (GRCh38) Human (GRCh38)
Location 7:13515620-13515642 7:13515666-13515688
Sequence CCCGGATTGTTTTTGTTGTGGTT GGTTTCCATGACCCCTCTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 68, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!