ID: 1020906203_1020906213

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1020906203 1020906213
Species Human (GRCh38) Human (GRCh38)
Location 7:14067210-14067232 7:14067256-14067278
Sequence CCGCCCACCACTGCTGTTTGCCG TCCATCCCTCCAGATCTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 64, 2: 129, 3: 77, 4: 232} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!