ID: 1020916436_1020916443

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1020916436 1020916443
Species Human (GRCh38) Human (GRCh38)
Location 7:14199463-14199485 7:14199504-14199526
Sequence CCACCATGAAATCAAAGTAAGAT CTCTGCAGGCGGCCTGGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 263} {0: 1, 1: 1, 2: 4, 3: 36, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!