ID: 1020933269_1020933273

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1020933269 1020933273
Species Human (GRCh38) Human (GRCh38)
Location 7:14427337-14427359 7:14427365-14427387
Sequence CCCATATCACTATCAGCAGTTTG AGCCATTCAACAAGTCTCTAGGG
Strand - +
Off-target summary No data {0: 234, 1: 252, 2: 195, 3: 100, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!