ID: 1020941574_1020941577

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1020941574 1020941577
Species Human (GRCh38) Human (GRCh38)
Location 7:14545645-14545667 7:14545667-14545689
Sequence CCTCACAATAGCTGCTCAGCAGG GATTTAAGAATTGCTACACTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!