ID: 1020967371_1020967377

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1020967371 1020967377
Species Human (GRCh38) Human (GRCh38)
Location 7:14888387-14888409 7:14888435-14888457
Sequence CCTCTTCCTTACTGGGCATCTTA TTTTCCTCTTTGTGTGAATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 185} {0: 1, 1: 0, 2: 3, 3: 54, 4: 541}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!