ID: 1021060160_1021060163

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1021060160 1021060163
Species Human (GRCh38) Human (GRCh38)
Location 7:16101308-16101330 7:16101355-16101377
Sequence CCAATTATTGCCTCAATTTCAGA CTTCCTGGTTAGTTTAGTCTTGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 7, 3: 21, 4: 329} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!