|
Left Crispr |
Right Crispr |
| Crispr ID |
1021093363 |
1021093369 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:16508680-16508702
|
7:16508710-16508732
|
| Sequence |
CCTGTAATCCCAGCACTTTGGGA |
GCAGTAGATTACCTGAAGTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 284556, 1: 262309, 2: 153276, 3: 130613, 4: 189623} |
{0: 1, 1: 1, 2: 21, 3: 364, 4: 2777} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|