ID: 1021106672_1021106699

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1021106672 1021106699
Species Human (GRCh38) Human (GRCh38)
Location 7:16646063-16646085 7:16646115-16646137
Sequence CCCCACCATTCCCCCGGGAGTGG CGGGGGCGGTACGGGAGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132} {0: 1, 1: 0, 2: 0, 3: 51, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!