|
Left Crispr |
Right Crispr |
| Crispr ID |
1021109807 |
1021109812 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:16680689-16680711
|
7:16680717-16680739
|
| Sequence |
CCTAGCTACTTGGGAGGCTGAGG |
GGATCACTTGAGCACCCTGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 92836, 1: 203589, 2: 246027, 3: 262461, 4: 302975} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|