ID: 1021112529_1021112533

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1021112529 1021112533
Species Human (GRCh38) Human (GRCh38)
Location 7:16711915-16711937 7:16711947-16711969
Sequence CCTCCCAGCTCATGCTGATTCAG CCACATCTTCTCTGAACTAATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 10, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!