ID: 1021136808_1021136813

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1021136808 1021136813
Species Human (GRCh38) Human (GRCh38)
Location 7:16974856-16974878 7:16974892-16974914
Sequence CCCTCCCATGACATGTGAGAATT TTCAAGATGAGATTTGAGTGTGG
Strand - +
Off-target summary {0: 18, 1: 266, 2: 1100, 3: 3696, 4: 6328} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!