ID: 1021136810_1021136813

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1021136810 1021136813
Species Human (GRCh38) Human (GRCh38)
Location 7:16974860-16974882 7:16974892-16974914
Sequence CCCATGACATGTGAGAATTATGG TTCAAGATGAGATTTGAGTGTGG
Strand - +
Off-target summary {0: 15, 1: 207, 2: 1103, 3: 3037, 4: 5286} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!