ID: 1021168905_1021168908

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1021168905 1021168908
Species Human (GRCh38) Human (GRCh38)
Location 7:17374062-17374084 7:17374105-17374127
Sequence CCAGGTGTAAGGTGTTAAAGTTG CCTTCAAGTCATTCCAGCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 7, 3: 52, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!