ID: 1021189660_1021189665

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1021189660 1021189665
Species Human (GRCh38) Human (GRCh38)
Location 7:17605157-17605179 7:17605194-17605216
Sequence CCATTCATATATTAAATAAAATA ATCAGTAAAAAAAAGGATGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 51, 4: 611}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!