ID: 1021195655_1021195663

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1021195655 1021195663
Species Human (GRCh38) Human (GRCh38)
Location 7:17671691-17671713 7:17671740-17671762
Sequence CCAATGGTAGCACATCTAGCAAA ATTTACAATGGCTGGGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 204} {0: 1, 1: 0, 2: 1, 3: 35, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!