ID: 1021207661_1021207664

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1021207661 1021207664
Species Human (GRCh38) Human (GRCh38)
Location 7:17805101-17805123 7:17805132-17805154
Sequence CCAAAGAACAGAAACTGGCTTGA TTGAAAAACATGACCACTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 226} {0: 1, 1: 0, 2: 2, 3: 20, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!