ID: 1021209564_1021209565

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1021209564 1021209565
Species Human (GRCh38) Human (GRCh38)
Location 7:17830518-17830540 7:17830534-17830556
Sequence CCTCTTATTCTTGGTGGTAGATT GTAGATTATCTTGAAAACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 154} {0: 1, 1: 0, 2: 3, 3: 21, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!