ID: 1021227069_1021227075

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1021227069 1021227075
Species Human (GRCh38) Human (GRCh38)
Location 7:18040268-18040290 7:18040304-18040326
Sequence CCCTCATTTAAAAACCCCTTTGC TTTGTCAAGGCCTTCATTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 230} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!