ID: 1021232288_1021232292

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1021232288 1021232292
Species Human (GRCh38) Human (GRCh38)
Location 7:18100541-18100563 7:18100588-18100610
Sequence CCAAGTAGTCATATTTAGTGTGT TCATCTCTTGAAGTTCAATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 138} {0: 1, 1: 1, 2: 16, 3: 56, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!