ID: 1021232392_1021232395

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1021232392 1021232395
Species Human (GRCh38) Human (GRCh38)
Location 7:18101508-18101530 7:18101521-18101543
Sequence CCCATTCCTTTTCTCTTCCATGT TCTTCCATGTAAAACCTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 77, 4: 796} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!