ID: 1021236260_1021236265

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1021236260 1021236265
Species Human (GRCh38) Human (GRCh38)
Location 7:18146016-18146038 7:18146064-18146086
Sequence CCAGCAAAAGAGTCTTCATGCTG AAGAAAAAGAGATCAAGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 144} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!